Programiranje genoma s CRISPR-om

Kako znanstvenici uređuju genome uz pomoć računala

CRISPR (izgovara se "bistriji") dio je bakterijskog imunološkog sustava koji je evoluirao za "pamćenje" i uklanjanje invazivnog virusnog DNA.

Naziv je skraćen za „Redovito klasterirano ponavljani kratki paindromski ponavljanja“. No usprkos akronimu i složenom biološkom podrijetlu, njegova je inženjerska primjena jednostavna. Da biste započeli, postoji samo jedan protein koji morate razumjeti - Cas9.

Cas9 traži određenu sekvencu DNK i reže je razbijanjem oba lanca DNA molekule. Ovaj je protein koristan istraživačima jer ga mogu "programirati" za ciljanje bilo kojeg DNA sekvence. Molekula sgRNA (RNA) s jednim vodičem određuje slijed na koji se Cas9 veže. RNA je biološka molekula slična DNA koja se može vezati za proteine ​​i DNK.

sgRNA su kratki nizovi s konstantnom regijom i varijabilnom regijom. Konstantno područje veže sgRNA na protein Cas9. Promjenjiva regija uzrokuje da se Cas9 veže na slijed DNK koji ga nadopunjuje (vidi donji dijagram).

Cas9 protein koji se veže na DNK kada je PAM slijed na prednjem (gornjem) lancu. Podebljani slijed je ciljni slijed, zeleni je sgRNA, a tri plava znaka su PAM. Trokut pokazuje gdje će Cas9 izrezati DNK.

Izrada sgRNA je jeftina i brza. To omogućava istraživačima da brzo postave eksperiment Cas9 koji smanjuje bilo koji slijed DNK. Pa, zapravo nije bilo koji slijed. Postoji malo ograničenje: ciljni niz mora biti okružen točnim PAM (protospacer susjednim motivom) - kratkim nizom DNA.

Streptococcus pyogenes je zarazna vrsta bakterija. U inačici Cas9 koju proizvodi, motiv PAM-a je "NGG", gdje je N bilo koji nukleotid ("slova" koja čine DNA).

Srećom, motiv 'NGG' se javlja otprilike jednom svakih 42 baze u ljudskom genomu. To znači da istraživači mogu pronaći ciljno mjesto u blizini gotovo svakog slijeda od interesa.

Ovisno o postavljenom eksperimentu, ovi rezovi u DNK mogu prouzročiti slučajnu promjenu ili preciznu promjenu u slijedu DNK (o tome više o tome kasnije).

Prije skoka u pisanje ovog programa, preporučujem proučavanje Cas9 dijagrama u nastavku.

Cas9 protein se veže na DNK sekvencu kada je PAM slijed na reversu (dnu) lancu.

Imajte na umu da DNK i RNA imaju usmjerenost na temelju njihove kemijske strukture. Jedan kraj molekule naziva se 5 '(' pet-prime ') kraj, a drugi se naziva 3' ('tri-prime') kraj. To je važno, jer nizovi 5` - AGG - 3` nisu isti kao 3` - AGG - 5`.

Prema dogovoru, pretpostavlja se da su sekvence DNA i RNA napisane od 5 do 3, osim ako je drugačije označeno. Sekvence koje se čitaju u smjeru 5` - 3` nazivaju se nizovima "naprijed". Sekvence koje se čitaju na drugi način (3` - 5`) nazivaju se "obrnutim" nizovima. Ovo je proizvoljna konvencija.

Dijagram gore prikazuje primjer vezane uz Cas9 kada je PAM na naličju.

Vaš prvi CRISPR program

Scenarij

Znanstvenik ima DNK slijed koji nas zanima i želi popis svih CRISPR ciljeva sadržanih u nizu. Ručno pronalaženje svakog cilja je zamorno i podložno pogreškama.

Znanstvenik želi jednostavan program u koji mogu unijeti DNK slijed i vratiti sva moguća ciljana Cas9 mjesta. Znanstvenici bi također željeli položaj reza i PAM sekvencu za svako ciljno mjesto.

PRIMJER ULAZ (sa slike 1): 'CCACGGTTTCTGTAGCCCCATACTTTGGATG'
PRIMJER IZLAZA: [{
    'cut_pos': 6,
    'pam_seq': 'TGG',
    'target_seq': 'GTATGGGGCTACAGAAACCG',
    'struna': 'obrnuto'
  }, {
    'cut_pos': 22,
    'pam_seq': 'TGG',
    'target_seq': 'GTTTCTGTAGCCCCATACTT',
    'struna': 'naprijed'
  }
]

Prvo, kako pronaći CRISPR ciljeve u nizu? Zapamtite da se Cas9 protein može vezati bilo gdje gdje postoji 'NGG' motiv.

Prvi korak je probijanje kroz niz koji traži podudarnosti. Kad program nađe utakmicu "NGG", od početka PAM stranice želimo oduzeti tri pozicije, jer tamo Cas9 siječe DNK.

Zatim želimo zabilježiti dvadeset baza prije PAM-a kao ciljni slijed. Zvuči dobro?

Pa, gore opisani algoritam zapravo bi propustio otprilike polovicu svih CRISPR mjesta - jer je DNK dvolančan. To znači da ako je "CCN" niz na prednjem niti, onda je "NGG" niz na naličju.

Program također mora pretraživati ​​'CCN' koristeći sličnu logiku za obrnuti niz.

Primjer programa

Nisu svi ciljevi CRISPR-a jednaki

Kad se CRISPR prvi put uključio, istraživači su često povlačili redoslijed na svojem računalu i ručno birali ciljeve. Dizajn optimalne sgRNA sada je postao mnogo složeniji. Ispod su kratki uvodi u ovu složenost.

Off-ciljeva

Istraživači su ubrzo shvatili da će se Cas9 ponekad vezati i rezati na lokusima koji ne odgovaraju točno ciljnom slijedu. Ovi ne-ciljni rezovi uzrokovali bi nenamjerne promjene u eksperimentu istraživača (ili potencijalno pacijentovu genomu u slučaju terapije!)

Da bi stvorio dobar vodič, program mora pregledati cjelokupni genom (što iznosi otprilike 3 milijarde nukleotida za ljude) kako bi izračunao rezultat izvan cilja. Istraživači su također nedavno dizajnirali protein Cas9 da ima manje izvan ciljane aktivnosti.

Nokautirati

Kad se Cas9 veže, stvara se rez tako da se dvostruki lanac probije na molekulu DNK. Većinu vremena stanica može popraviti taj proboj biokemijskim putem (zvanim nehomologno krajnje spajanje ili NHEJ).

Ova putanja nije uvijek savršena, a ponekad kada se Cas9 reže, postupak popravka čini malo umetanje ili brisanje u slijedu DNK. U regionu DNA kodiranog proteinom, ove male umetanja i brisanja uzrokuju mutaciju u pomaku okvira - što će često poremetiti funkciju proteina.

Istraživači će često nokautirati gen kako bi shvatili kako protein utječe na određenu staničnu funkciju ili fenotip. Stvaranje nokaut uređivanja dodaje dodatna ograničenja dizajnu sgRNA, jer sada vodič mora pristati u području kodiranja gena.

montaža

Umjesto da izbaci gen, znanstvenik želi mnogo puta urediti preciznost. Ovo je posebno korisno kada pokušavate ispraviti bolest koja uzrokuje mutaciju. Najbolji način za to još uvijek se istražuje. Većina metoda uključuje dodavanje dodatnog dijela DNA.

Rezultat cilja

Neke sgRNA sekvence uzrokovat će rezanje Cas9 bolje od drugih. Istraživači su usporedili učinkovitost rezanja u tisućama Cas9 ciljeva kako bi stvorili prediktivne modele učinkovitosti rezanja sgRNA.

Microsoft čak podržava skladište otvorenog koda za "Predučno modeliranje na bazi strojnog učenja za CRISPR / Cas9 učinkovitost vodiča".

Ostali CRISPR-Cas sustavi

Istraživači su otkrili CRISPR-Cas sustave u drugim bakterijama. Ovi drugi sustavi imaju različite PAM-ove.

Završne napomene

Nadam se da ste naučili nešto novo! Ako želite saznati više o biologiji, medicinskim primjenama, komercijalnim aplikacijama ili etičkim implikacijama inženjeringa genoma CRISPR-Cas, onda preporučujem čitanje filma Crack in Creation Jennifer Doudna i Samuela Sternberga. Jennifer Doudna jedno je od originalnih otkrića CRISPR-ovih podloga.

o autoru

Ranije sam bio preddiplomski istraživač u laboratoriju Gersbach na Sveučilištu Duke, a trenutno sam softverski inženjer u Synthego.